rs147030584 chr3:51941930 C>A
- Sequence
cgtggcagctgaaccctcccagct[C/A]cccagccgcctggcaagaccccgc
- ASB in cell types
- breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.81 | n/a | 3.00 |
Items per page:
1 – 1 of 1