rs147225237 chr7:1160341 C>T
- Sequence
ccgcgccccgcaggcccgcccact[C/T]ctcgcttctccacttcccttctcg
- ASB in cell types
- A673 (Ewing sarcoma) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- MYBB_HUMAN SUH_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MYBB_HUMAN | -2.88 | 3.05 | 1.00 | n/a | No Hit | |||
| SUH_HUMAN | 2.46 | -4.69 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood