rs147676762 chr6:95561289 C>T
- Sequence
tttcctagacagaggtccctgtgg[C/T]cttccacagtgtattgtgtccctg
- ASB in cell types
- embryonic stem cells derived definitive endoderm definitive endoderm from HUES8
- ASB for transcription factors
- GATA6_HUMAN GATA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA6_HUMAN | 1.53 | -0.29 | 1.17 | n/a | No Hit | |||
| GATA4_HUMAN | 2.74 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2