rs147684576 chr5:128538228 C>G
- Sequence
caagagagagggcgggaggctggg[C/G]gctggagaagatgcggcggtggag
- ASB in cell types
- SEM (childhood B acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SEM (childhood B acute lymphoblastic leukemia) | 1.67 | -0.03 | 1.17 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Coronary, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid