rs147910897 chr2:60497683 T>C
- Sequence
cactttgcaccttccagagcaatt[T/C]aacatcctttactttttttggaag
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | -1.13 | 1.95 | 1.00 |
Items per page:
1 – 1 of 1