rs147928960 chr5:71778853 G>A
- Sequence
gctgccatttcaacagtccccact[G/A]tatggcagaagcagcctgctcaat
- ASB in cell types
- HeLa (cervical adenocarcinoma) GM17942 (lymphoblastoid cell) HeLa S3 (cervical adenocarcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.78 | 1.02 | 1.64 | 2.88 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
