rs148013315 chr19:44722243 G>A
- Sequence
acccgaggcacacaggctccaggc[G/A]ggaagttggcgacaagttgtggac
- ASB in cell types
- HL-60 (acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HL-60 (acute myeloid leukemia) | 0.36 | 1.23 | 1.17 |
Items per page:
1 – 1 of 1