rs148032002 chr7:4792241 G>A
- Sequence
acgttccgcccggtgcctgggacg[G/A]gctcagccgccagggggcgccgcc
- ASB in cell types
- retinal pigment epithelial cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| retinal pigment epithelial cells | 2.21 | -1.89 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Nerve_Tibial, Testis