rs148242676 chr4:8336614 A>G
- Sequence
cttcctcctggtgaacacctccat[A/G]tggaacatccagatacaaccttct
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | 0.93 | 2.39 | 2.00 | 3.72 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid