rs148250664 chr5:146203500 T>G
- Sequence
gcgagcgagccttttcattggtct[T/G]gccctcagggccccctctctctta
- ASB in cell types
- endometrial stromal cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| endometrial stromal cells | 2.56 | n/a | 3.00 |
Items per page:
1 – 1 of 1