rs148313098 chr3:127547978 C>G
- Sequence
ggcgcggagcgactgcactgtgcc[C/G]gggctgcactgggggcgagaggcc
- ASB in cell types
- THP-1 (acute monocytic leukemia) spleen
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.77 | 0.51 | 1.02 | |||
| spleen | 1.33 | -1.33 | 1.00 |
Items per page:
1 – 2 of 2