rs148481206 chr6:143536779 G>T
- Sequence
tgcagctttcgcccgctggagcga[G/T]agccggctgtaggcggctccttcc
- ASB for transcription factors
- KMT2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KMT2A_HUMAN | -0.76 | 1.17 | 1.00 | -2.47 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
