rs148855233 chr16:89667249 A>G
- Sequence
tggtggccctgtctgggcataaca[A/G]aaggctcacactcttgtcttctgg
- ASB in cell types
- pancreas GM18951 (B-cells Lymphoblastoid Cell Lines) SYO-1(Biphasic synovial sarcoma) thyroid gland
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | 2.52 | -2.19 | 1.00 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | -1.64 | 1.42 | 1.33 | |||
| SYO-1(Biphasic synovial sarcoma) | 2.28 | -4.19 | 1.50 | |||
| thyroid gland | 2.14 | -1.58 | 1.00 |
Items per page:
1 – 4 of 4