rs149280913 chr16:87588855 C>G
- Sequence
cggggagtgcacgggcatttgcaa[C/G]cttttgcgggtggaatcgcacaca
- ASB in cell types
- RCC 7860 (Renal cell carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RCC 7860 (Renal cell carcinoma) | -4.52 | 2.63 | 1.50 |
Items per page:
1 – 1 of 1