rs149448842 chr15:75776331 C>A
- Sequence
tgacccaatcccctaagcattctc[C/A]ccccatttctggttcctctggttg
- ASB in cell types
- iPS-derived dermal fibroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| iPS-derived dermal fibroblasts | 1.82 | -1.59 | 1.00 |
Items per page:
1 – 1 of 1