rs149489509 chr8:143278777 G>A
- Sequence
gcagctcctggaggggcggggagg[G/A]ggcggggccatgcgcactcgcggc
- ASB in cell types
- tibial nerve
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| tibial nerve | -0.12 | 1.81 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Tibial, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg