rs149491010 chr1:108560026 C>A
- Sequence
cgccccgccgtgcgctgcaggccg[C/A]ggccgctgggggcgcccccgaccc
- ASB in cell types
- glioblastoma cells 2588 (Lymphoblastoid Cell Lines) thymus-derived CD34+ cells GM02255 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- BC11B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BC11B_HUMAN | 1.95 | -1.50 | 2.50 | n/a | n/a |
Items per page:
1 – 1 of 1