rs149492594 chr7:267336 A>G
- Sequence
agcgcccagggtcagcatggcccc[A/G]ccgcctccctcagcccggcccaga
- ASB in cell types
- HUES64 (embryonic stem cells) gastrocnemius medialis
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUES64 (embryonic stem cells) | -1.85 | 2.25 | 1.00 | |||
| gastrocnemius medialis | -1.77 | 2.32 | 1.00 |
Items per page:
1 – 2 of 2