rs149527410 chr5:141702375 A>G
- Sequence
ttccgcaggctcccgggtgagcgc[A/G]tccaaggccgcccccactccccgc
- ASB in cell types
- HMEC (human mammary epithelial cells)
- ASB for transcription factors
- STAG2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG2_HUMAN | 2.58 | -2.24 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1