rs149555924 chr1:17336267 T>G
- Sequence
cgctcctttcctacttctactgga[T/G]tctccccgggcgcccccttgtggt
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) human astrocytes from spinal cord
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.44 | 0.63 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1