rs150932 chr16:2252616 G>C
- Sequence
ccagccgggccaatatgatgaaac[G/C]ccgtctctactagaaatacaaaaa
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.71 | 0.14 | 1.98 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood