rs151195 chr17:43946742 T>C
- Sequence
gatcattgctcactacagcgatgt[T/C]tcatgggctcaagggatcctgcca
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | 2.08 | -1.64 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, hdl cholesterol, hdl cholesterol change with statins, ldl cholesterol, ldl cholesterol change with statins, microalbuminuria, serum creatinine, total cholesterol, total cholesterol change with statins, triglycerides, urinary albumin-to-creatinine ratio