rs151591 chr10:113953807 A>G
- Sequence
tattaggtaattaggtttagatga[A/G]gtcatgaaagtgagccccaaggtg
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.83 | 0.24 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, diastolic blood pressure (dbp), hdl cholesterol, rapid visual processing, sporadic creutzfeldt-jakob disease