rs155525 chr3:37522222 G>A
- Sequence
tccacagtgaggacatcaggaagt[G/A]agcctcccctgggggaccatgcag
- ASB in cell types
- embryonic stem cells derived definitive endoderm
- ASB for transcription factors
- GATA6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA6_HUMAN | 0.45 | 1.70 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, college completion, cystatin c in serum, diastolic blood pressure (dbp), mitral annular calcium, systolic blood pressure (sbp), total cholesterol, urinary albumin-to-creatinine ratio