rs15651 chr1:110338323 G>C
- Sequence
acccggagtacttgggcgggaacg[G/C]gtagctcgcgggagagacgggctc
- ASB in cell types
- HepG2 (hepatoblastoma) GM18526 (B – cells Lymphoblastoid Cell Lines) Peyer's patch CUTLL1 (T-cell lymphoblastic lymphoma 1)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.43 | 1.04 | 1.09 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 2.25 | -1.91 | 1.00 | |||
| Peyer's patch | 1.37 | -0.84 | 1.00 | |||
| CUTLL1 (T-cell lymphoblastic lymphoma 1) | -0.38 | 1.75 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, chronic kidney disease, microalbuminuria, serum creatinine
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid