rs157227 chr1:28893243 A>G
- Sequence
ctccaccacacacacctaattttc[A/G]tattttttgtagagatggggtttc
- ASB for transcription factors
- ILF3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ILF3_HUMAN | 1.83 | -1.57 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid