rs157557 chr5:73938758 T>C
- Sequence
gactgcgtgttgtgaccacaggca[T/C]gctttgtctcccagtgtggtaaaa
- ASB in cell types
- SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | 1.90 | -2.06 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, birth weight, diastolic blood pressure (dbp), systolic blood pressure (sbp)