rs158689 chr9:90895479 A>T
- Sequence
cagaggccctgcttgtgatcagca[A/T]tttttcacaagcacattgacaaac
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line) KMS-11 (Plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7L-P(immortalized breast epithelial cell line) | 0.94 | 0.02 | 2.00 | |||
| KMS-11 (Plasma cell myeloma) | -0.08 | 1.30 | 1.50 |
Items per page:
1 – 2 of 2