rs158921 chr5:60945315 G>A
- Sequence
gagatcgctgtcaagggaagtgaa[G/A]gagcacgtgggcacggaccaattc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | -1.44 | 1.99 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, ldl cholesterol, obesity with early age of onset (age >2), parkinsons disease, serum creatinine, years of education
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cortex, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Lung, Muscle_Skeletal, Pancreas, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood