rs158922 chr5:60945159 A>G
- Sequence
agaagggctccaggatggaggccg[A/G]cctgacttctccgcctcggtgggc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | -3.83 | 2.07 | 1.50 | |||
| HepG2 (hepatoblastoma) | 0.87 | 0.97 | 1.22 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Pancreas, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood