rs159380 chr5:61132954 G>A
- Sequence
cttctccaatcccataataagaag[G/A]gaaaagcttgcactgtcttcataa
- ASB in cell types
- GM23338
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23338 | 2.15 | -1.95 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Lung, Muscle_Skeletal, Pancreas, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood