rs160939 chr5:56201160 C>T
- Sequence
gcattcctctaattccctctctcc[C/T]cctgcgggattatcctgaatgctt
- ASB in cell types
- HUES64 (embryonic stem cells) HUVEC-C (HUVEC, umbilical vein endothelial cells) GM19193 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUES64 (embryonic stem cells) | 1.78 | -0.41 | 1.17 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 2.18 | 0.28 | 2.62 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -0.53 | 0.52 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, ldl cholesterol, neuroblastoma (brain cancer), rheumatoid arthritis, schizophrenia, total cholesterol, triglycerides