rs162317 chr20:57237222 A>G
- Sequence
cacaccccactttaatgaggatga[A/G]gctcaaggggctaaaagaactaat
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ZN574_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN574_HUMAN | n/a | 3.09 | 4.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, autism with high iq, hdl cholesterol change with statins, infant head circumference, rheumatoid arthritis, systolic blood pressure (sbp)
GTEx eQTL Brain_Spinal_cord_cervical_c-1, Brain_Substantia_nigra, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis