rs162330 chr2:38092354 C>A
- Sequence
cccggtggtgatttgtacaaatga[C/A]gcaacgctatccagcttcccagaa
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) BEAS-2B (bronchial epithelium) tibial nerve macrophages
- ASB for transcription factors
- GCR_HUMAN EP300_HUMAN JUND_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 2.72 | 0.05 | 1.83 | n/a | No Hit | |||
| EP300_HUMAN | 2.18 | 0.18 | 1.30 | n/a | n/a | |||
| JUND_HUMAN | 2.92 | -4.33 | 1.33 | -2.43 | Concordant | |||
| JUN_HUMAN | 2.74 | -4.15 | 1.33 | -3.11 | Concordant | |||
| PPARG_HUMAN | 1.28 | -0.85 | 1.75 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GRASP birth weight, homa-b, psoriasis and/or psoriatic arthritis, psoriasis only (no arthritis), psoriatic arthritis, transmission distortion
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Liver, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid