rs163184 chr11:2825839 T>G
- Sequence
ccagggactggggcaagggtggag[T/G]ttggagtaaagagagaggcagggc
- ASB in cell types
- BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 0.38 | 1.32 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, adiponectin levels, birth weight, birth weight and type 2 diabetes, coronary artery disease (cad), fasting blood glucose, gestational diabetes mellitus, homa-b, schizophrenia, triglycerides, triglycerides change with statins, type 2 diabetes, type 2 diabetes (females), type 2 diabetes (males)