rs163803 chr20:59005013 T>C
- Sequence
acaggcacctgttgacctttctat[T/C]ctcccctcaccctcaccccaccct
- ASB in cell types
- macrophages form periferal blood MDM(monocyte derived macrophages) CD14+ monocytes
- ASB for transcription factors
- SPI1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -4.65 | 2.81 | 2.00 | n/a | No Hit | |||
| STAT1_HUMAN | -4.63 | 3.04 | 2.00 | -3.86 | Discordant |
Items per page:
1 – 2 of 2
Motif analysis
