rs1663 chr7:13525332 C>T
- Sequence
taggataggctgcatctatcattt[C/T]tgcaacctctaatgaggtaaaagg
- ASB in cell types
- foreskin keratinocyte 2588 (Lymphoblastoid Cell Lines) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.67 | n/a | 2.33 | |||
| 2588 (Lymphoblastoid Cell Lines) | 0.70 | -0.77 | 1.00 | |||
| neural cell | 1.23 | -0.09 | 1.00 |
Items per page:
1 – 3 of 3