rs16776 chr1:204102229 C>T
- Sequence
aaaggtgagatttcatcagcctgg[C/T]gggtaaacatggctgtttgcagac
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | -0.01 | 2.48 | 1.91 | 2.59 | Concordant | |||
| FOXA2_HUMAN | -1.05 | 2.09 | 2.00 | 2.81 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP 2 hour glucose, chronic kidney disease, comorbid depressive syndrome and alcohol dependence, forward wave amplitude, hdl cholesterol, hypertension (early onset hypertension), serum creatinine