rs168130 chr5:13987731 A>G
- Sequence
agccaggcatggtggcgcacgcct[A/G]tagtcccagctacttgggaggctg
- ASB in cell types
- GM10847 (female B-cells Lymphoblastoid Cell Lines) epithelial cell of prostate
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | -0.79 | 2.42 | 1.00 | |||
| epithelial cell of prostate | -1.80 | 2.20 | 1.00 |
Items per page:
1 – 2 of 2