rs16825219 chr3:175259006 T>C
- Sequence
ttgccacttgtaatggtgactcat[T/C]aggcagtgaccagccagattaaag
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- CREB1_HUMAN MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | -4.16 | 3.03 | 1.50 | n/a | No Hit | |||
| MNT_HUMAN | -0.02 | 4.01 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), asthma, comorbid depressive syndrome and alcohol dependence, triglycerides