rs16829299 chr3:178318831 G>T
- Sequence
ctagcaatgcattcacctatttgg[G/T]ttattctctacacagaatagagtt
- ASB for transcription factors
- RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | -0.24 | 1.88 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP neuroticism, total cholesterol change with statins, triglycerides change with statins, waist hip ratio