rs16833769 chr1:236523695 C>G
- Sequence
cacctcccaccccactccgccttc[C/G]gggcaaaggcagccagatccaccc
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.54 | 1.08 | 3.52 | |||
| HepG2 (hepatoblastoma) | 0.74 | 0.44 | 1.08 |
Items per page:
1 – 2 of 2