rs16833797 chr1:152035238 A>T
- Sequence
ttgttctgttacaacatgcccttc[A/T]tatcaggcctaaaatctccctgtc
- ASB in cell types
- endometrial stromal cells
- ASB for transcription factors
- GATA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA2_HUMAN | 3.53 | n/a | 3.00 | 3.66 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid