rs16841912 chr1:197733346 G>C
- Sequence
ccctgacagttatttgcttaacct[G/C]tttttataaacacagcatacaaac
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA2_HUMAN | -3.76 | 2.28 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, hdl cholesterol change with statins, refractive error
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis