rs16844292 chr1:234963800 T>C
- Sequence
ggatgaccacaccggagaaaattc[T/C]acagaaacagttttgcggtcacag
- ASB in cell types
- breast tumor breast tumour metastasis ZR-75-1 (invasive ductal carcinoma)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.73 | n/a | 3.60 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, fasting blood glucose, hdl cholesterol, ldl cholesterol, total cholesterol
GTEx eQTL Adipose_Visceral_Omentum, Colon_Transverse, Liver, Lung, Ovary, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Thyroid, Whole_Blood