rs16844588 chr1:172484661 T>C
- Sequence
ttcctcatagttctccatttcctc[T/C]gtcattcaagaatgagaaagatag
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.26 | 0.41 | 1.45 | -1.71 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, asthma, fasting insulin, height, homa-b, homa-ir, parkinsons disease, prop taste detection threshold, stabilized warfarin dose, systolic blood pressure (sbp), trailsa, variant creutzfeldt-jakob disease