rs16848184 chr1:201268848 T>C
- Sequence
ccatctggctcttcttcccatcac[T/C]gccagactcccttgtaccatggca
- ASB in cell types
- BE2C
- ASB for transcription factors
- HAND2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HAND2_HUMAN | 2.84 | n/a | 1.50 | -1.20 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP decrease in fev1/fvc ratio (in nonasthmatic participants), fasting insulin, homa-ir, years of education