rs16848499 chr1:175482014 G>T
- Sequence
gcctccacaaccacaccctgcctc[G/T]tgttgtcacactacacaccaaccg
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) epithelial cell of prostate
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 2.07 | -1.50 | 1.00 | |||
| epithelial cell of prostate | 1.78 | -1.49 | 1.00 |
Items per page:
1 – 2 of 2