rs16856186 chr1:205708998 T>G
- Sequence
agagctaaatattagaggtcttat[T/G]gcttcccttaagtgcatggcaaga
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 3.17 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), decrease in fev1 (in asthmatic ever smokers), decrease in fev1 (in asthmatic never smokers), decrease in fev1 (in asthmatic participants >=30 years old), decrease in fev1 (in asthmatic participants), infant head circumference, lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants)