rs16856823 chr2:169343942 A>T
- Sequence
gtgagaatagcatagaatttttgc[A/T]aatacataaatatttactaactcc
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HS-SY-2(Monophasic synovial sarcoma) | -0.71 | 1.36 | 1.29 |
Items per page:
1 – 1 of 1